MODY8 CEL

Disease ID
MODY8
Gene ID
CEL
Updated
May 6, 2026
v2.19.0
Suggest Edit

Disease

Name
Maturity-Onset Diabetes of the Young Type 8
Inheritance
Autosomal dominant
Description
Maturity-onset diabetes of the young type 8 (MODY8) is characterized by onset of diabetes before age 25 years, with slowly progressive pancreatic exocrine dysfunction, fatty replacement of pancreatic parenchyma (lipomatosis), and development of pancreatic cysts1 . Other types of this disease have been associated with various genes and variant types. Comorbidity has been proposed between MODY and fecal elastase deficiency (FED).
Prevalence
Found in individuals of Danish and Norwegian ancestry2,3 .
Age of OnsetYears11  17
Age of Onset Details
11-173

Locus

Details
The locus contains 17 imperfect 33 bp motifs, with a stretch of 7 perfect GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG motifs. Several pathogenic mutations have been proposed. A single basepair deletion causing a frameshift mutation2,3 . Another is a 1bp deletion of (C)8 to (C)7 within the VNTR, causing a motif change (this is the pathogenic motif represented here). Also, a contraction that deletes one of the VNTR repeats may be pathogenic, with reduced penetrance, although evidence for this is sparse3 . Another study identified a c.2041_2042delinsCGG p.(Val681Argfs*6) mutation in the 12th motif (one of the imperfect motifs)4 . Several non-tandem repeat pathogenic MODY variants have also been reported in this gene. Given limited data and multiple proposed pathogenic variants, the normal and pathogenic ranges are currently difficult to define.
Mechanism
Loss of function at the protein level may be part of the molecular mechanism. Research suggests that the mutations disrupt the C-terminal protein, leading to reduced stability of the mutant lipase in vitro2 .
Year
2005
Location in Gene
Exon 11
Gene Strand

Alleles

Ref. Motif
GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG
Pathogenic (ref.)
GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG
Pathogenic (gene)
ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC

References

Direct supporting references for info on this page.

2
Mutations in the CEL VNTR cause a syndrome of diabetes and pancreatic exocrine dysfunction.
Helge,Raeder, Stefan,Johansson, Pål I,Holm, Ingfrid S,Haldorsen, Eric,Mas, Véronique,Sbarra, Ingrid,Nermoen, Stig A,Eide, Louise,Grevle, Lise,Bjørkhaug, Jørn V,Sagen, Lage,Aksnes, Oddmund,Søvik, Dominique,Lombardo, Anders,Molven, Pål Rasmus,Njølstad
Nature genetics · 2005-12-20
pmid:16369531
3
Mutations in the VNTR of the carboxyl-ester lipase gene (CEL) are a rare cause of monogenic diabetes.
Janniche,Torsvik, Stefan,Johansson, Anders,Johansen, Jakob,Ek, Jayne,Minton, Helge,Raeder, Sian,Ellard, Andrew,Hattersley, Oluf,Pedersen, Torben,Hansen, Anders,Molven, Pål R,Njølstad
Human genetics · 2009-09-17
pmid:19760265
4
Unraveling the genetic basis of MODY: insights from next-generation sequencing.
Metin,Eser, Gulam,Hekimoglu, Fatma,Dursun
Journal of applied genetics · 2024-10-03
pmid:39361122

Additional Literature

Additional literature related to this locus.

Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem repeats, and disease, in medline format)

Dexamethasone prophylaxis for excessive lymphocyte expansion after cilta-cel in multiple myeloma.
Peter A,Forsberg, Jacqueline A,Turner, Marita,Meyer, Diana,Abbott, Sara,Nicholson, Henning,Schade, Jeffrey,Matous, Tara,Gregory
Blood advances · 2026-05-26
pmid:41894686
Routine Monitoring of CAR-T-Cells Expansion and Persistence in Patients With Aggressive Large B-Cell Lymphoma by Flow Cytometry: A Single-Center Experience.
Alexandra,Zduniak, Jérémie,Martinet, Emilie,Lévêque, Stéphanie,Becker, David,Tonnelet, Elodie Dos,Santos, Claire,Leroy, Mustafa,Alani, Jean,Rouvet, Marine,Brousseau, Camille,Giverne, Alexis,Cuffel, Serge,Jacquot, Arnaud,Roucheux, Alice,Veuiller, Nicolas,Lecornu, Misa Eugene,Norbert, Olivier,Boyer, Hervé,Tilly, Fabrice,Jardin, Jean-Baptiste,Latouche, Vincent,Camus
Hematological oncology · 2025-11-01
pmid:41057236
Early-onset diabetes with low utilization of lipid as an energy source carrying a rare missense mutation in the CEL gene.
Ayana,Fujii, Hiroko,Nakabayashi, Yuko,Nagao, Masaru,Akiyama, Akihiko,Taguchi, Kaito,Yorimoto, Risako,Hamada, Issei,Saeki, Naoki,Yamamoto, Taro,Takami, Kenji,Watanabe, Yoichi,Mizukami, Yasuharu,Ohta
Endocrinology, diabetes & metabolism case reports · 2025-08-18
pmid:40840513
Characterizing Cellular Expansion of Idecabtagene Vicleucel and Association with Clinical Efficacy and Safety in Patients with Triple-Class-Exposed Relapsed/Refractory Multiple Myeloma.
Fan,Wu, Xirong,Zheng, Joseph,Burnett, Madhan,Masilamani, Wanying,Zhang, Xiaobo,Zhong, Andrea,Caia, Mark,Cook, Julia,Piasecki, Anna,Kondic, Manisha,Lamba, Jian,Zhou
Journal of clinical pharmacology · 2025-07-10
pmid:40641008
Brexucabtagene autoleucel in-vivo expansion and BTKi refractoriness have a negative influence on progression-free survival in mantle cell lymphoma: Results from CART-SIE study.
Federico,Stella, Annalisa,Chiappella, Martina,Magni, Francesca,Bonifazi, Chiara,De Philippis, Maurizio,Musso, Ilaria,Cutini, Silva,Ljevar, Anna Maria,Barbui, Mirko,Farina, Massimo,Martino, Massimo,Massaia, Giovanni,Grillo, Piera,Angelillo, Barbara,Botto, Francesca,Patriarca, Mauro,Krampera, Luca,Arcaini, Maria Chiara,Tisi, Pierluigi,Zinzani, Federica,Sorà, Stefania,Bramanti, Martina,Pennisi, Cristiana,Carniti, Paolo,Corradini
British journal of haematology · 2024-12-22
pmid:39710966
Common single-base insertions in the VNTR of the carboxyl ester lipase (CEL) gene are benign and also likely to arise somatically in the exocrine pancreas.
Ranveig S,Brekke, Anny,Gravdal, Khadija,El Jellas, Grace E,Curry, Jianguo,Lin, Steven J,Wilhelm, Solrun J,Steine, Eric,Mas, Stefan,Johansson, Mark E,Lowe, Bente B,Johansson, Xunjun,Xiao, Karianne,Fjeld, Anders,Molven
Human molecular genetics · 2024-05-18
pmid:38483348
Unlocking Predictive Power: Quantitative Assessment of CAR-T Expansion with Digital Droplet Polymerase Chain Reaction (ddPCR).
Eugenio,Galli, Marcello,Viscovo, Federica,Fosso, Ilaria,Pansini, Giacomo,Di Cesare, Camilla,Iacovelli, Elena,Maiolo, Federica,Sorà, Stefan,Hohaus, Simona,Sica, Silvia,Bellesi, Patrizia,Chiusolo
International journal of molecular sciences · 2024-02-26
pmid:38473919
Early Chimeric Antigen Receptor T Cell Expansion Is Associated with Prolonged Progression-Free Survival for Patients with Relapsed/Refractory Multiple Myeloma Treated with Ide-Cel: A Retrospective Monocentric Study.
Leo,Caillot, Emmanuel,Sleiman, Ingrid,Lafon, Marie-Lorraine,Chretien, Pauline,Gueneau, Alexandre,Payssot, Romain,Pedri, Daniela,Lakomy, François,Bailly, Julien,Guy, Jean-Pierre,Quenot, Herve,Avet-Loiseau, Denis,Caillot
Transplantation and cellular therapy · 2024-03-07
pmid:38458477
The genetic risk factor CEL-HYB1 causes proteotoxicity and chronic pancreatitis in mice.
Karianne,Fjeld, Anny,Gravdal, Ranveig S,Brekke, Jahedul,Alam, Steven J,Wilhelm, Khadija,El Jellas, Helene N,Pettersen, Jianguo,Lin, Marie H,Solheim, Solrun J,Steine, Bente B,Johansson, Pål R,Njølstad, Caroline S,Verbeke, Xunjun,Xiao, Mark E,Lowe, Anders,Molven
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.] · 2022-11-09
pmid:36379850